-actin was used as the loading control. collagen deposition in a dose-dependent manner and promoted migration of cultured tenocytes. APC dose-dependently stimulated phosphorylated (P)-ERK2 and inhibited P-p38. Interestingly, tenocytes expressed EPCR protein, which was up-regulated by APC. When tenocytes were pre-treated with RCR252 or EPCR siRNA the effect of APC on proliferation, MMP-2 and type 1 collagen synthesis and MAP kinases was blocked. APC promotes the growth, MMP-2 activity, type I collagen deposition and migration of tenocytes. Furthermore, EPCR is expressed by tenocytes and mediates the actions of APC, at least partly by signalling through selective MAP kinases. These data implicate APC as a potential healing agent for injured tendons. MAP kinases. Materials and methods Tenocyte isolation, culture and reagents A segment of the superficial digital tendon was isolated from an adult sheep (about 10 g of tissue) immediately after slaughter and cut into small fragments. The tissue was digested in 25 ml of phosphate buffered saline (PBS) containing collagenase type I (1 mg/ml) and 15 ml of trypsin (25 mg/ml) for 6 hrs at 37C with continuous stirring. Tissue debris were removed by filtration on nylon gauze and the enzymes were inactivated by the addition of 3 ml foetal calf serum (FCS). After centrifugation (350g, 10 min.) the pellet was RS102895 hydrochloride resuspended in DMEM supplemented with 10% FCS (V/V) and the cells were seeded onto cell culture flasks. The cells were incubated at 37C, in a 95% humiditified atmosphere with 5% CO2. The medium was replaced after 48 hrs and then every 3 days. The tenocytes employed for all tests were used at three to five passages. After confluency, cells were trypsinised and seeded into either 24-well culture plates at 2 105 cells per well or eight-well perm anox? slides (Nalge Nunc International Corp., Rochester, NY USA) and incubated for 12 hrs to allow for adhesion. The confluent cells were then treated with recombinant APC (Xigris, Eli Lilly, Indianapolis, IN USA), and/or EPCR blocking antibody RCR252, EPCR non-blocking antibody RCR92 (gift from Professor Fukudome, Department of Immunology Saga Medical School, Nabeshima, Saga, Japan). Cells and culture supernatants were collected for detection of mRNA and protein expression. Small interfering (si) RNA preparation and nucleofection siRNA duplex oligonucleotides were purchased from Proligo (Sigma-Proligo, St. Louis, MO, USA). The designed siRNA for EPCR was: sense 5 GUGGACGGCGAUGUUAAUUAC, antisense UCCACCUGCCGCUACAAUUAA-5. A scrambled form of EPCR siRNA was used as a negative control. Tenocytes were adjusted to 1 1.5 105 cells/ml in growth medium and subjected to nucleofection using the siPORTs? NeoFX? according to the manufacturer’s instructions (Amaxa Biosystems, Cologne, Germany). Transfected cells were allowed to attach overnight, trypsinised and then seeded into either 24-well plates (1 105 cells/well), 8-well permanox? slides (Nalge Nunc International Corp.) or 96-well plates (2 103 cells/well) and incubated for a further 24, 48 and 72 hrs. The specificity of EPCR siRNA (10 nM) was confirmed by EPCR blocking antibody RCR252. RNA extraction and reverse-transcription (RT)-PCR Total RNA was extracted from tenocytes using Tri Reagent (Sigma-Aldrich St. Louis, MO, USA) according to the manufacturer’s instructions. Single stranded Rabbit polyclonal to ETFDH cDNA was syn thesized from total RNA using AMV reverse transcriptaseand Oligo (dT)15 as a primer (Promega Corp., Madison, WI, USA). The levels of mRNA were semi-quantified using real time PCR on a Rotorgene 3000A (Corbett Research, Sydney, Australia). Samples were normalized to the housekeeping gene RPL13A and results were reported for each sample relative to the control. PCR product was also RS102895 hydrochloride separated by 2% agarose gel electrophoresis. Primers used were as follows: EPCR (91bp): Sense 5TCCTACCTGCTCCAGTTCCA and antisense AAGATGCCTACAGCCACACC; GAPDH (139bp): sense 5CCT GGA GAA ACC TGC CAA GTA TG and antisense 5GGT AGA AGA GTG AGT GTC GCT GTT G. Cell proliferation assay Cells (2 103 cells/well) were seeded into a 96-well micro plate to a final volume of 200 l, and incubated for 4 hrs to allow cells to attach. Cells were then treated with APC at 0.01, 0.1, 1, 10 (g/ml). After incubation for 72 hrs, culture medium was removed and cells were stained with 1 g/ml crystal violet (Sigma, Aldrich) dissolved in PBS. The unbound dye was removed by washing with tap water and cells were left to completely dry overnight. Bound crystal violet was solubilized with 1% SDS in PBS. The optical density of each well was determined at a wavelength of 550 nm. Results were expressed as percentages of controls. Migration assay Cells were seeded into 24-well plates and cultured to confluence. Cell monolayers were then scratched with a 1000 l blue plastic pipette tip, RS102895 hydrochloride creating a.
Categories