The (fusion gene was constructed, with the promoter fused to a reporter gene. to form the stem-loop structure by analysis of its RNA secondary structure. The message. operon, encoding an ATP-dependent protease, was originally discovered as part of the heat shock apparatus [1]. In the operon, the first gene, (reviewed in [15-17]). Upon heat shock, protein misfolding leads to a cascade of intracellular protein synthesis, usually dependent on a sigma factor, i.e., 32, for their gene expression. The 32 consensus binding sequences are found in the upstream region of the gene lies 71 bases upstream from the start codon (Fig. ?1A1A). An untranslated region (UTR) upstream of this mRNA contains a 20 bp inverted repeat (IR) sequence 5CCCCGTACTTTTGTACGGGG3, Tnfrsf1b which is unique for the operon (Fig. ?1A1A). In addition, from the wild bacterial genome, the 5UTR of also exists in other bacterial species (Fig. ?1B1B). Fig. (1) (A) Nucleotide sequences of the promoter region of the operon [1]. The transcriptional start site is shown by arrows. The consensus -10 and -35 sequences recognized by 32 are underlined. The SD region and the start codon GTG of … In this study, we analyzed mRNA production in wild-type (wt) cells versus sigma-factor deficient mutants using a fusion gene, in which a chromosomal reporter. We demonstrated that the expression of the reporter gene is induced in the wild-type cells but not in fusion gene, carrying a C to T mutation in the -10 promoter site for RpoH-binding, showed a decreased gene expression. No additional sigma factor was identified for an activation of its gene expression. Thus, through a genetic analysis, the promoter is recognized by 32. In addition, a stem-loop structure (IR) at the 5 end of the UTR of gene expression. MATERIALS AND METHODOLOGY Materials and Media Bacterial strains and phages used in this study are listed in Table ?11. LB complex media was purchased from Difco and the bacteria were grown in LB broth, with an addition of the appropriate antibiotics as required. Supplements were added as the following final concentrations when needed: 100 g ampicillin (Ap) ml-1; 40 mg X-gal ml-1. The Taq L189 manufacture DNA polymerase, restriction endonucleases, and other enzymes were obtained from Takara, New England BioLabs and Biolab (Taipei). Chemicals were obtained from Sigma or Wako. Table 1 The Strains and Phages Used in this Study P1 L189 manufacture Transduction and Other General Methods P1XL-1 blue competent cells were used. Plasmid transformations were performed as described by Chung promoter (141 bps)-promoter (141 bps)-promoter (478 bps)-promoter (478 bps)-promoter, the Shine-Dalgarno (SD) site, and the first thirteen amino acids of in pRS414 [22], a translational in pRS415 plasmid with a transcriptional fusion (op). Two sets of primers were used. Set 1: F1 and R1. Set 2: F2, R1. The PCR conditions were performed according to the manufacturers instructions, and then the PCR products were purified with Viogene Gel-M kits. Both pRS414 and pRS415 plasmids were cut with upstream of in pRS415 and in pRS414, were designated pSY5 and pSY6, respectively. Several PCR steps were then used to construct a promoter and its adjacent region. The upstream region primers L189 manufacture were F2 and R2. The downstream primers were F4 and R3. Two overlapping PCR fragments were then used as the template and were amplified by the primers of F2 and R3. The resulting DNA fragment with a 40 bp deletion within the leader sequences (as shown in Fig. ?1A1A) was cloned into pRS415 and pRS414 at (pSY7) and pRS414-(pSY10) and pBAD33-(pSY11) were constructed as described below. Using the pWF1 [9] as the template, the various DNA fragments surrounding the upstream region of gene and the upstream region alone were separately PCR-amplified. The resulting DNA fragments were cloned in series into the pBAD33 at the clpQ+itself. The F5 and R4 primers were used. The plasmid pBAD33-and itself under the pBAD promoter, was constructed, using F6 and R4 primers to amplify a DNA fragment of was constructed, in which the 15 nucleotides upstream of the first GTG codon and itself were under the pBAD promoter control. To generate (pSY12) was constructed, which carries the substituted T sequences at the 5 end of the UTR of (indicated with bold in the primer F8), using the F8 and R4 primers. Plasmid pBAD33-(pSY13) carries the substituted nucleotides at the 5 end of UTR of (pSY14) was constructed as follows. Using the pWF1 as the template, the was amplified, and the resulting DNA fragment was cloned into the pBAD24 at the Fusion Gene.