History The epidermal growth factor receptor (EGFR) has been reported to be overexpressed in anaplastic thyroid carcinoma (ATC). in tumour tissues from 23 patients with ATC. Results On mutational analysis and FISH neither mutations in the hot‐spots nor gene amplification was observed. However high polysomy was identified in 14/23 (60.9%) patients with ATC. All cases with immunohistochemistry (IHC) positivity (n?=?6) had high polysomy whereas 8/17 (47.1%) cases with IHC negativity had high polysomy (p?=?0.048). High polysomy was observed in all 10 cases with giant cell subtype but in only 4/11 (36.3%) with squamoid and 0/2 with spindle cell sarcomatoid subtype. There was no statistically significant correlation between FISH positivity of ATC tumour and presence of well‐differentiated component. Conclusion Despite the low incidence of somatic gene mutation and amplification in the study BMS-790052 samples in view of the fact that high polysomy was often HOXA11 identified by FISH as well as the current lack of therapeutic options EGFR TKIs are worth investigating for treating the patients with ATC who have at least giant cell subtype. gene mutations that are clustered within the tyrosine kinase domain were recently reported to be associated with the sensitivity of small molecule TKIs.6 7 8 Furthermore a high gene copy number BMS-790052 including gene amplification and high polysomy has been shown to be significantly associated with a better response and improved BMS-790052 survival for non‐small cell lung cancer (NSCLC).9 10 Therefore as indicators for the effectiveness of TKIs the mutational status of the tyrosine kinase domain and a high gene copy number of the gene in different primary cancers may have important clinical consequences although there are still numerous questions to be answered concerning the relevant biological parameters. BMS-790052 Based on these current results we analysed the mutational status of the tyrosine kinase domain and the gene copy number of the gene in ATC tissues to infer whether TKIs may have anti‐tumour activity against ATC; if BMS-790052 so this would provide a rationale for clinical trials with TKIs. Materials and methods Tissue samples and pathology We retrieved tumour tissue samples from 23 patients with ATC from the archives of the Departments of Pathology at Seoul National University Hospital Seoul Korea and at the National Cancer Center Goyang Korea. The pathological diagnosis was made by three professional pathologists (GKL SYP and SHP) according to the World Health Organization classification; the representativeness of the samples was reconfirmed from the H&E stained slides by GKL. The patients’ ages ranged from 52 to 80 years with a median age of 63 years. There were 7 men and 16 women. The subtypes of ATC were as follows: 11 squamoid; 7 giant cell; 2 spindle cell sarcomatoid; and 3 mixed giant and spindle cell sarcomatoid. Of note 13 (56.5%) cases contained a well‐differentiated component. There was no paucicellular variant. Immunohistochemistry Expression of EGFR was determined by means of immunohistochemistry (IHC) using the mouse anti‐human EGFR (clone H11 monoclonal antibody; DakoCytomation Carpinteria California USA). Evaluation was done according to the proportion of reactive cells within the tumours. The proportion score described the estimated fraction of positively stained tumour cells (0 no visible reaction; 1 <10%; 2 10 3 50 of the tumour cells were stained). When >10% of tumour cells showed membranous staining of any intensity (score 2 or 3 3) the tumour was considered positive for EGFR. Fluorescence in situ hybridisation Fluorescence in situ hybridisation (FISH) studies were performed using the LSI EGFR SpectrumOrange/CEP7 Spectrum Green probe (Vysis Abbott Laboratories Abbott Park Illinois BMS-790052 USA). We analysed 50 non‐overlapping tumour cell nuclei for the observed number of red (gene and we classified them according to the six FISH categories defined by Cappuzzo gene were amplified using PCR assays with the following primers: exon 18 GACCCTTGTCTCTGTGTTCTTGT (forward) TATACAGCTTGCAAGGACGG (reverse outside) and CCAGACCATGAGAGGCCCTG (reverse inside); exon 19 CACAATTGCCAGTTAACGTCTTC (forward) AGGGTCTAGAGCAGAGCAGC (reverse outside) and GCCTGAGGTTCAGAGCCAT.