Moxon, G

Moxon, G. bactericidal epitopes is an important step in the design of fresh vaccines against meningococci. Serogroups A, B, C, Y, and W135 of are the most common causes of bacterial sepsis and meningitis in children and adolescents. Capsular polysaccharide-based vaccines have been developed for prevention of disease caused by serogroups A, C, Y, and W135 strains; however, this approach has not been relevant to serogroup B (16). Consequently, serogroup B human population showed the protein can be divided into three main variants (19). Conservation within each variant ranges between 91.6 and 100%, while between the variants the conservation can be as low while 62.8%. The protein is indicated by all strains of strains (19). Recent studies have confirmed the importance of this protein in inducing bactericidal antibodies against (10) and have shown that safety QX 314 chloride in the infant rat model using monoclonal antibodies (MAbs) against GNA 1870 can also be accomplished in the absence of measurable bactericidal activity (37). To further characterize the immunological properties of GNA 1870, we generated polyclonal antisera and a monoclonal antibody with bactericidal activity against the protein or its domains and used them to map linear and conformational epitopes. We found that most of the practical epitopes are located in one region and that arginine 204 is definitely a key residue for any protective epitope. MATERIALS AND METHODS Strains. DH5 [F? 80(rBmB(strains MC58, 961-5945, BZ83, F6124, BZ133, M1239, and NZ98/254 were previously explained (7, 19). Strains M2934, M4030, and M2197 are medical isolates from the United States, kindly provided by Tanja Popovic (Centers for Disease Control and Prevention, Atlanta, Ga.). Isogenic MC58, M2934, and BZ83 knockout mutants, in which the gene was truncated and replaced with an erythromycin antibiotic cassette, were generated as previously explained (19). GNA 1870 cloning, manifestation, and purification in genes from strains MC58, 961-5945, and M1239, coding for variants 1, 2, and 3, respectively, were indicated in as previously explained (19). Mixtures of ahead (DNA sequences coding for domains A, B, C, Abdominal, and BC, respectively. Forward primers included, like a tail, the CGCGGATCCCATATG sequence comprising the NdeI restriction site, whereas reverse primers included the sequence CCCGCTCGAG, comprising the XhoI restriction site (restriction sites are underlined). Open in a separate windowpane FIG. 1. DNA QX 314 chloride sequence of the gene coding for the adult form of GNA 1870 variant 1 (strain MC58). The sequences of the oligonucleotides used in this study are underlined. To generate the cross B3C website, the sequence coding for the B3 website was amplified from strain M1239 (variant 3) using the following oligonucleotides: (CGCGGATCCCATATGCAGAACCACTCCGCCGT) and (GCCCAAGCTTGCCATTCGGGTCGTCGG), comprising the NdeI and HindIII restriction sites, respectively; the sequence coding for the C website (variant 1) was amplified using (which includes the HindIII restriction site in the GCCCAAGCTT sequence added like a tail) and oligonucleotides. In all cases, the PCR conditions were as follows: 94C for 30 s, 52C for 30 s, and 72C for 1 min (5 cycles); 94C for 30 s, 65C for 30 s, and 72C for 1 min (30 cycles). PCRs were performed on 10 ng of MC58 (variant 1) or M1239 (variant 3) chromosomal DNA, using AmpliTaq DNA polymerase (Perkin-Elmer). Amplified DNA fragments related to the A, B, C, Abdominal, and BC domains were digested with NdeI and XhoI enzymes IL17B antibody (BioLabs) and cloned into the pET-21b+ manifestation vector (Novagen) digested with NdeI and XhoI. Amplified fragments coding for the B3 and C domains were digested with NdeI-HindIII and HindIII-XhoI, respectively, and cloned into pET-21b+ digested with NdeI-XhoI to express the B3C website like a C-terminal His tag fusion. DNA sequencing was QX 314 chloride performed using an ABI 377 Automatic Sequencer, and sequence analysis was performed using Editview, GeneJockey, and MacBoxshade software. Recombinant plasmids were transformed into BL21 Celebrity (DE3), used as an expression host strain, and recombinant proteins were indicated as C-terminal His tag fusions. Recombinant strains were grown at.